Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU029181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tcp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTAACGCAGACGAACTTGGAAGAGACTGTCTGACCAATACTGCTAAGACATCCATGTCTTCCAAAATTATTGGAATAAATGGTGATTACTTTGCTAATATGGTAGTAGATGCTGTGCTTGCTGTTAAATACACAGATGCCAGAGGCCAGCCTCGCTATCCAATCAATTCTGTTAATATTCTGAAAGCCCATGGGAGAAGTCAGATAGAAAGCATGCTGATCAATGGCTATGCGCTCAATTGTGTGGTTGGATCTCAGGGCATGCCCAAGAGAATAGTTAATGCAAAAATTGCTTGTCTTGACTTCAGCCTGCAGAAAACAAAAATGAAGCTTGGTGTACAGGTGGTTATTACAGACCCTGAGAAATTGGACCAAATTAGACAGAGAGAATCGGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGCATTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuai Ye et al.
International journal of oncology, 44(6), 2153-2159 (2014-04-11)
p63 is a member of the p53 protein family and plays a crucial role in epithelial development. p63 is expressed in many types of tumors including esophageal cancer; however, its function in cancer is controversial and its role in esophageal
Renata L Linardi et al.
Veterinary dermatology, 26(4), 213-e47-213-e47 (2015-05-13)
The limited characterization of equine skin, eye and hoof epithelial stem cell (ESC) and differentiation markers impedes the investigation of the physiology and pathophysiology of these tissues. To characterize ESC and differentiation marker expression in epithelial tissues of the equine
Hulda R Jonsdottir et al.
Laboratory investigation; a journal of technical methods and pathology, 95(12), 1418-1428 (2015-09-22)
Idiopathic pulmonary fibrosis (IPF) is a progressive interstitial lung disease with high morbidity and mortality. The cellular source of the fibrotic process is currently under debate with one suggested mechanism being epithelial-to-mesenchymal transition (EMT) in the alveolar region. In this

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico