Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU011231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATACCACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGCAATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATACAAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCTTCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGAGTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAGTCCTTCCTACCCCAATTTCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yong Xia et al.
Molecular and cellular biochemistry, 398(1-2), 147-156 (2014-09-23)
Piperine, a kind of natural alkaloid found in peppers, has been reported to exhibit anti-oxidative and anti-tumor activities, both in vitro and in vivo. Interleukin-6 (IL-6) is an important cytokine that activates the signal transduction, promotes tumor cell metastasis, and
Victoria Ingham et al.
Journal of neuroinflammation, 11, 115-115 (2014-06-24)
Activated microglia are associated with deposits of aggregated proteins within the brains of patients with Alzheimer's disease (AD), Parkinson's disease (PD) and prion diseases. Since the cytokines secreted from activated microglia are thought to contribute to the pathogenesis of these
Shijia Zhang et al.
Stem cells (Dayton, Ohio), 32(6), 1616-1628 (2014-01-23)
Adipose-derived stromal/stem cells (ASCs) have anti-inflammatory as well as immunosuppressive activities and are currently the focus of clinical trials for a number of inflammatory diseases. Acute lung injury (ALI) is an inflammatory condition of the lung for which standard treatment

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico