Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU001091

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Elavl1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCAGAACATGACCCAAGAGGAACTACGAAGTCTGTTCAGCAGCATTGGCGAGGTTGAATCTGCAAAGCTTATTCGGGATAAAGTAGCAGGACACAGCTTGGGCTACGGTTTTGTGAACTATGTGACTGCAAAAGATGCAGAGAGAGCAATCAGCACACTGAACGGCTTGAGACTCCAGTCCAAAACCATTAAGGTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAAAGATGCCAACTTATACATCAGTGGGCTCCCAAGGACCATGACACAGAAGGATGTGGAAGACATGTTTTCTCGGTTTGGGCGAATCATCAACTCCAGGGTCCTTGTGGATCAGACCACAGGTTTGTCCAGAGGGGTTGCCTTTATCCGGTTTGACAAACGGTCAGAAGCAG

Ensembl | mouse accession no.

ENSMUSG00000040028

NCBI accession no.

NP_034615

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... ELAVL1(15568) , Elavl1(15568)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Danping Wu et al.
Clinical laboratory, 61(11), 1625-1634 (2016-01-07)
Increasing evidence suggests that microRNAs are widely involved in cancer progression and metastasis. However, the specific role of miR-31 in papillary thyroid carcinoma (PTC) is still largely unknown. The level of miR-31 and HuR was detected in 30 pairedcancerous and
Kotb Abdelmohsen et al.
Nucleic acids research, 42(15), 10099-10111 (2014-08-16)
Noncoding RNAs (ncRNAs) and RNA-binding proteins are potent post-transcriptional regulators of gene expression. The ncRNA 7SL is upregulated in cancer cells, but its impact upon the phenotype of cancer cells is unknown. Here, we present evidence that 7SL forms a
Kenneth K W To et al.
Experimental cell research, 338(2), 222-231 (2015-09-20)
Colorectal cancer (CRC) is a major cause of mortality and morbidity worldwide. While surgery remains the mainstay of treatment for early stage CRC, adjuvant chemotherapy is usually given to reduce the risk of recurrence after colectomy. Overexpression of a multidrug
Stephen M Kraynik et al.
Biochimica et biophysica acta, 1849(6), 688-696 (2015-03-03)
Heat shock protein 70.3 (Hsp70.3) expression increases in response to cellular stress and plays a cytoprotective role. We have previously shown that Hsp70.3 expression is controlled through coordinated post-transcriptional regulation by miRNAs and alternative polyadenylation (APA), and APA-mediated shortening of
Jeong-Dan Cha et al.
Head & neck, 36(8), 1168-1175 (2013-07-16)
HuR expression has been noted in several cancer types, in which it may contribute to increased expression of cellular inhibitors of apoptosis protein-2 (cIAP2) observed during tumorigenesis. To assess the correlation between cIAP2 and HuR in cases of oral squamous
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico