Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU227251

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGAGACTCAGCAACGACCCATACCTCAGACCCGACGGCCCGGAGCGGAGCGCGCCCTGCCCTGGCGCAGCCAGAGCCGCCGGGTGCCCGCTGCAGTTTCTTGGGACATAGGAGCGCAAAGAAGCTACAGCCTGGACTTACCACCACTAAACTGCGAGAGAAGCTAAACGTGTTTATTTTCCCTTAAATTATTTTTGTAATGGTAGCTTTTTCTACATCTTACTCCTGTTGATGCAGCTAAGGTACATTTGTAAAAAGAAAAAAAACCAGACTTTTCAGACAAACCCTTTGTATTGTAGATAAGAGGAAAAGACTGAGCATGCTCACTTTTTTATATTAATTTTTACAGTATTTGTAAGAATAAAGCAGCATTTGAAATCGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

David A Knowles et al.
PLoS computational biology, 15(5), e1006743-e1006743 (2019-05-29)
Drug screening studies typically involve assaying the sensitivity of a range of cancer cell lines across an array of anti-cancer therapeutics. Alongside these sensitivity measurements high dimensional molecular characterizations of the cell lines are typically available, including gene expression, copy
Kenjiro Tanaka et al.
British journal of pharmacology, 173(6), 1058-1069 (2016-01-12)
The sympathetic nervous system regulates bone remodelling, in part, through ß2 -adrenoceptor signalling. However, the physiological role of α1 -adrenoceptor signalling in bone in vivo remains unclear. Therefore, to obtain a deeper understanding of bone remodelling by the sympathetic nervous
Leonie Hartl et al.
Cancers, 12(9) (2020-09-11)
CCAAT/enhancer-binding protein δ (C/EBPδ) is a transcription factor involved in growth arrest and differentiation, which has consequently been suggested to harbor tumor suppressive activities. However, C/EBPδ over-expression correlates with poor prognosis in glioblastoma and promotes genomic instability in cervical cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico