Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU159061

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cristian Rodriguez-Aguayo et al.
EBioMedicine, 40, 290-304 (2019-01-19)
Inflammatory mediator prostaglandin E2-prostaglandin E2 receptor EP3 (PTGER3) signaling is critical for tumor-associated angiogenesis, tumor growth, and chemoresistance. However, the mechanism underlying these effects in ovarian cancer is not known. An association between higher tumoral expression of PTGER3 and shorter
Yao Ye et al.
Journal of cancer research and clinical oncology, 146(9), 2189-2203 (2020-06-04)
Cervical cancer metastasis results in poor prognosis and increased mortality, which is not separated from inflammatory reactions accumulated by prostaglandin E2 (PGE2). As a specific G-protein coupled PGE2 receptor, EP3 is demonstrated as a negative prognosticator of cervical malignancy. Now
Ju-Fang Liu et al.
Molecular cancer, 9, 43-43 (2010-02-25)
Cyclooxygenase (COX)-2, the inducible isoform of prostaglandin (PG) synthase, has been implicated in tumor metastasis. Interaction of COX-2 with its specific EP receptors on the surface of cancer cells has been reported to induce cancer invasion. However, the effects of
Chenggang Li et al.
Molecular cancer research : MCR, 15(10), 1318-1330 (2017-07-16)
Tuberous sclerosis complex (TSC) is a tumor-suppressor syndrome affecting multiple organs, including the brain, skin, kidneys, heart, and lungs. TSC is associated with mutations in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico