Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU158111

Sigma-Aldrich

MISSION® esiRNA

targeting human TIA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGTCCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGTCAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTTGTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGTCATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAAATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuzo Abe et al.
Cell & bioscience, 11(1), 122-122 (2021-07-05)
Tumor protein D52 (TPD52) reportedly plays an important role in the proliferation and metastasis of various cancer cells, including oral squamous cell carcinoma (OSCC) cells, and is expressed strongly at the center of the tumor, where the microenvironment is hypoxic.
Xuefeng Yang et al.
Biochimie, 154, 119-126 (2018-08-26)
Gastric cancer (GC) is one of the most common malignancies as well as the third leading cause for cancer-related death. Molecular basis of GC are essential and critical for its therapeutic treatment, but still remain poorly understood. T-cell intracellular antigen-1
Jovan Nikolic et al.
PLoS pathogens, 12(10), e1005942-e1005942 (2016-10-18)
Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress
Alice Pasini et al.
Biochimica et biophysica acta, 1861(5), 463-472 (2018-03-21)
Cyclooxygenase-2 (COX-2), with its main antifibrotic metabolite PGE2, is regarded as an antifibrotic gene. Repressed COX-2 expression and deficient PGE2 have been shown to contribute to the activation of lung fibroblasts and excessive deposition of collagen in pulmonary fibrosis. We

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico