Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU158101

Sigma-Aldrich

MISSION® esiRNA

targeting human JAG2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGGAGAAGTTCCTCTCACACAAATTCACCAAAGATCCTGGCCGCTCGCCGGGGAGGCCGGCCCACTGGGCCTCAGGCCCCAAAGTGGACAACCGCGCGGTCAGGAGCATCAATGAGGCCCGCTACGCCGGCAAGGAGTAGGGGCGGCTGCCAGCTGGGCCGGGACCCAGGGCCCTCGGTGGGAGCCATGCCGTCTGCCGGACCCGGAGGCCGAGGCCATGTGCATAGTTTCTTTATTTTGTGTAAAAAAACCACCAAAAACAAAAACCAAATGTTTATTTTCTACGTTTCTTTAACCTTGTATAAATTATTCAGTAACTGTCAGGCTGAAAACAATGGAGTATTCTCGGATAGTTGCTATTTTTGTAAAGTTTCCGTGCGTGGCACTCGCTGTATGAAAGGAGAGAGCAAAGGGTGTCTGCGTCGTCACCAAATCGTAGCGTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shouwen Chen et al.
Fish & shellfish immunology, 95, 277-286 (2019-11-02)
Interleukine-1β (IL-1β) is the first identified pro-inflammatory cytokine, which is cleaved by caspase-1 following the inflammasomes activation, playing critical roles in innate immunity. However, few studies have been performed to characterize the IL-1β in lower vertebrates. Herein, we distinguished the
Mo-fei Li et al.
Developmental and comparative immunology, 51(1), 141-147 (2015-03-25)
In mammals, CD83 is a surface marker on mature dendritic cells and vital to lymphocyte activation. In teleost, studies on the function of CD83 are very limited. In this study, we examined the potential involvement of turbot (Scophthalmus maximus) CD83
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico