Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU156191

Sigma-Aldrich

MISSION® esiRNA

targeting human TM4SF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAAAAGAACCAACCCAGGACAGAGCCACAATCTTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Young Ran Park et al.
International journal of oncology, 48(5), 2135-2143 (2016-03-18)
Transmembrane-4-L6 family 1 (TM4SF1) is upregulated in colorectal carcinoma (CRC). However, the mechanism leading to inhibition of the TM4SF1 is not known. In the present study, we investigated the regulation of TM4SF1 and function of microRNAs (miRNAs) in CRC invasion
Yu-Cheng Su et al.
mAbs, 6(4), 1069-1083 (2014-05-31)
Modification of antibody class and binding properties typically requires cloning of antibody genes, antibody library construction, phage or yeast display and recombinant antibody expression. Here, we describe an alternative "cloning-free" approach to generate antibodies with altered antigen-binding and heavy chain
Yonghoon Kwon et al.
PloS one, 9(9), e108771-e108771 (2014-09-25)
5' AMP-activated protein kinase (AMPK) is a highly conserved serine-threonine kinase that regulates energy expenditure by activating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. Therefore AMPK activators are considered to be drug targets for treatment of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico