Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU152211

Sigma-Aldrich

MISSION® esiRNA

targeting human SHARPIN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGTGCTCTTGGCTGTGCACGCCGCGGTGAGGCCGCTGGGCGCCGGGCCAGACGCCGAGGCACAGCTGCGGAGGCTGCAGCTGAGCGCGGACCCTGAGCGGCCTGGGCGCTTCCGGCTGGAGCTGCTGGGCGCGGGACCTGGGGCGGTTAATTTGGAGTGGCCCCTGGAGTCAGTTTCCTACACCATCCGAGGCCCCACCCAGCACGAGCTACAGCCTCCACCAGGAGGGCCTGGAACCCTCAGCCTGCACTTCCTCAACCCTCAGGAAGCTCAGCGGTGGGCAGTCCTAGTCCGAGGTGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dhanya Krishnan et al.
Neurobiology of aging, 93, 131-141 (2020-03-14)
Defective immune cell-mediated clearance of amyloid-beta (Aβ) and Aβ-associated inflammatory activation of immune cells are key contributors in pathogenesis of Alzheimer's disease (AD). However, the underlying mechanisms remain elusive. Shank-associated RH domain-interacting protein (SHARPIN) is a critical regulator of inflammatory
Emilia Peuhu et al.
The EMBO journal, 36(2), 165-182 (2016-12-16)
SHARPIN is a widely expressed multifunctional protein implicated in cancer, inflammation, linear ubiquitination and integrin activity inhibition; however, its contribution to epithelial homeostasis remains poorly understood. Here, we examined the role of SHARPIN in mammary gland development, a process strongly
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico