Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU151161

Sigma-Aldrich

MISSION® esiRNA

targeting human MZF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGATGGGTCACAGTCCAGGTGCAGGGCCAGGAGGTCCTATCAGAGAAGATGGAGCCCTCCAGTTTCCAGCCCCTACCTGAAACTGAGCCTCCAACTCCAGAGCCTGGGCCCAAGACACCTCCTAGGACTATGCAGGAATCACCACTGGGCCTGCAGGTGAAAGAGGAGTCAGAGGTTACAGAGGACTCAGATTTCCTGGAGTCTGGGCCTCTAGCTGCCACCCAGGAGTCTGTACCCACCCTCCTGCCTGAGGAGGCCCAGAGATGTGGGACCGTGCTGGACCAGATCTTTCCCCACAGCAAGACTGGGCCTGAGGGTCCCTCATGGAGGGAGCACCCCAGGGCCCTGTGGCATGAGGAAGCTGGGGGCATCTTCTCCCCAGGGTTCGCGCTGCAGCTAGGCAGCATCTCCGCAGGTCCAGGTAGTGTAAGCCCTCACCTCCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

C E Weber et al.
Oncogene, 34(37), 4821-4833 (2014-12-23)
Interactions between tumor cells and cancer-associated fibroblasts (CAFs) in the tumor microenvironment significantly influence cancer growth and metastasis. Transforming growth factor-β (TGF-β) is known to be a critical mediator of the CAF phenotype, and osteopontin (OPN) expression in tumors is
Lanfang Wu et al.
The FEBS journal, 284(18), 3000-3017 (2017-07-14)
Tumor metastasis remains a major obstacle for improving overall cancer survival in cervical cancer (CC), which may be due to the existence of tumor microenvironment-related cancer stem cells (CSCs) and epithelial-mesenchymal transition (EMT). The mechanism underlying these processes needs to
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico