Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU147511

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Quanfeng Wu et al.
Cancer cell international, 17, 62-62 (2017-06-09)
To study the mechanism by which epithelial ovarian cancer (EOC)-derived exosomes restore the migration of endothelial cells that is suppressed by TAM-derived exosomes. Exosomes were isolated from TAMs in the ascites of patients with EOC. The effect of exosomes on
Yancan Liang et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 47(6), 583-589 (2018-03-27)
Tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) has been proved to play an important role in tumorigenesis, invasion, and metastasis. However, its precise role salivary adenoid cystic carcinoma (SACC) has not been determined. The aim of this study was
Ge Song et al.
Frontiers in immunology, 12, 649020-649020 (2021-03-16)
Myeloid-derived suppressor cells (MDSCs) are immature heterogeneous cells derived from the bone marrow and they are the major component of the tumor-induced immunosuppressive environment. Tumor necrosis factor receptor-associated factor 6 (TRAF6), an E3 ubiquitin ligase, catalyzes the polyubiquitination of target
Eugenia M Yazlovitskaya et al.
Matrix biology : journal of the International Society for Matrix Biology, 77, 101-116 (2018-09-09)
Integrins, the major receptors for cell-extracellular matrix (ECM) interactions, regulate multiple cell biological processes including adhesion, migration, proliferation and growth factor-dependent signaling. The principal laminin (LM) binding integrins α3β1, α6β1 and α6β4 are usually co-expressed in cells and bind to
Carrie M Rosenberger et al.
PLoS pathogens, 13(4), e1006305-e1006305 (2017-04-06)
Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico