Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU147311

Sigma-Aldrich

MISSION® esiRNA

targeting human CORO1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCACCCAGACACGATCTACAGTGTGGACTGGAGCCGAGATGGAGGCCTCATTTGTACCTCCTGCCGTGACAAGCGCGTGCGCATCATCGAGCCCCGCAAAGGCACTGTCGTAGCTGAGAAGGACCGTCCCCACGAGGGGACCCGGCCCGTGCGTGCAGTGTTCGTGTCGGAGGGGAAGATCCTGACCACGGGCTTCAGCCGCATGAGTGAGCGGCAGGTGGCGCTGTGGGACACAAAGCACCTGGAGGAGCCGCTGTCCCTGCAGGAGCTGGACACCAGCAGCGGTGTCCTGCTGCCCTTCTTTGACCCTGACACCAACATCGTCTACCTCTGTGGCAAGGGTGACAGCTCAATCCGGTACTTTGAGATCACTTCCGAGGCCCCTTTCCTGCACTATCTCTCCATGTTCAGTTCCAAGGAGTCCCAGCGGGGCATGGGCTACATGCCCAAACGTGGCCTGGAGGTGAACAAGTGTGAGATCGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carole Henique et al.
Nature communications, 8(1), 1829-1829 (2017-12-01)
Crescentic rapidly progressive glomerulonephritis (RPGN) represents the most aggressive form of acquired glomerular disease. While most therapeutic approaches involve potentially toxic immunosuppressive strategies, the pathophysiology remains incompletely understood. Podocytes are glomerular epithelial cells that are normally growth-arrested because of the
Matthew Van De Pette et al.
PLoS genetics, 12(3), e1005916-e1005916 (2016-03-11)
The accurate diagnosis and clinical management of the growth restriction disorder Silver Russell Syndrome (SRS) has confounded researchers and clinicians for many years due to the myriad of genetic and epigenetic alterations reported in these patients and the lack of
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico