Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU146001

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCGTCCCAAATACAGTTTCCGTCGCCTTGACGACAAGACCACCAACGTGTCCTTGTACCCTGGCTACAACTTCAGATACGCCAAGTACTACAAGGAAAACAATGTTGAGAAACGGACTCTGATAAAAGTCTTCGGGATCCGTTTTGACATCCTGGTTTTTGGCACCGGAGGAAAATTTGACATTATCCAGCTGGTTGTGTACATCGGCTCAACCCTCTCCTACTTCGGTCTGGCCGCTGTGTTCATCGACTTCCTCATCGACACTTACTCCAGTAACTGCTGTCGCTCCCATATTTATCCCTGGTGCAAGTGCTGTCAGCCCTGTGTGGTCAACGAATACTACTACAGGAAGAAGTGCGAGTCCATTGTGGAGCCAAAGCCGACATTAAAGTATGTGTCCTTTGTGGATGAATCCCAC

Ensembl | human accession no.

ENSG00000089041

NCBI accession no.

NM_002562

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... P2RX7(5027) , P2RX7(5027)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wang Lili et al.
Experimental biology and medicine (Maywood, N.J.), 244(9), 734-742 (2019-05-02)
The mechanism of gastric cancer is highly complex, accompanied by a variety of genetic abnormalities. It is of great significance to elucidate the pathogenesis of gastric cancer, find its markers and therapeutic targets in the fight against this fatal disease.
Hengli Zhao et al.
Scientific reports, 6, 23286-23286 (2016-03-17)
Blockading P2X7 receptor(P2X7R) provides neuroprotection toward various neurological disorders, including stroke, traumatic brain injury, and subarachnoid hemorrhage. However, whether and how P2X7 receptor suppression protects blood-brain barrier(BBB) after intracerebral hemorrhage(ICH) remains unexplored. In present study, intrastriatal autologous-blood injection was used
Shu Guan et al.
Frontiers in psychiatry, 10, 770-770 (2019-11-05)
Diabetic neuropathic pain (DNP) and major depressive disorder (MDD) are common complications of diabetes mellitus and mutually affect each other. As a member of the ATP-gated ion channel family, P2X7 receptor is associated with the transduction of pain signal and
Hui Pan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13533-13543 (2016-07-30)
Uveal melanoma (UM) has a high mortality rate for primary intraocular tumors. Approximately half of UM patients present with untreatable and fatal metastases. Long non-coding RNAs (lncRNAs) have emerged as potent regulatory RNAs that play key roles in various cellular
Miso Park et al.
Scientific reports, 9(1), 11587-11587 (2019-08-14)
Tamoxifen (TAM) is the standard anti-hormonal therapy for estrogen receptor-positive breast cancer. However, long-term TAM therapy can make acquisition of TAM resistance and there are still no solutions to treat TAM-resistant breast cancer. In this study, we found that protein
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico