Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU145621

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAGTGAAGAAGGCCCGTATAGCCATGGGTGGAGGCATAATTTTCATCGTGGCAGGTCTTGCCGCCTTGGTAGCTTGCTCCTGGTATGGCCATCAGATTGTCACAGACTTTTATAACCCTTTGATCCCTACCAACATTAAGTATGAGTTTGGCCCTGCCATCTTTATTGGCTGGGCAGGGTCTGCCCTAGTCATCCTGGGAGGTGCACTGCTCTCCTGTTCCTGTCCTGGGAATGAGAGCAAGGCTGGGTACCGTGTACCCCGCTCTTACCCTAAGTCCAACTCTTCCAAGGAGTATGTGTGACCTGGGATCTCCTTGCCCCAGCCTGACAGGCTATGGGAGTGTCTAGATGCCTGAAAGGGCCTGGGGCTGAGCTCAGCCTGTGGGCAGGGTGCCGGACAAAGGCCTCCTGGTCACTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Di Gao et al.
Theriogenology, 158, 346-357 (2020-10-11)
Trophectoderm (TE) barrier function is an essential prerequisite for blastocyst development. CLAUDIN7 (CLDN7), a member of CLAUDINS family, is involved in regulating intercellular exchange and cell polarity in epithelium cells. However, the role of CLDN7 in porcine early embryo development
Thanh Q Dang et al.
The Journal of endocrinology, 234(2), 101-114 (2017-07-15)
Altered permeability of the endothelial barrier in a variety of tissues has implications both in disease pathogenesis and treatment. Glucocorticoids are potent mediators of endothelial permeability, and this forms the basis for their heavily prescribed use as medications to treat
Norimitsu Okui et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 19(1), 88-96 (2018-11-13)
Pancreatic cancer consists of various subpopulations of cells, some of which have aggressive proliferative properties. The molecules responsible for the aggressive proliferation of pancreatic cancer may become molecular targets for the therapies against pancreatic cancer. From a human pancreatic cancer
Fabian Horné et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(9), 1181-1192 (2018-12-06)
Claudins are the major components of tight junctions and are often deregulated in human cancer, permitting escape of cancer cells along with the acquisition of invasive properties. Similarly, endometrial cells also show invasive capabilities; however, the role of tight junctions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico