Todas las fotos(1)

Key Documents

EHU145491

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human MEF2D

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

description

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACTGCCTACAACACAGATTACCAGTTGACCAGTGCAGAGCTCTCCTCCTTACCAGCCTTTAGTTCACCTGGGGGGCTGTCGCTAGGCAATGTCACTGCCTGGCAACAGCCACAGCAGCCCCAGCAGCCGCAGCAGCCACAGCCTCCACAGCAGCAGCCACCGCAGCCACAGCAGCCACAGCCACAGCAGCCTCAGCAGCCGCAACAGCCACCTCAGCAACAGTCCCACCTGGTCCCTGTATCTCTCAGCAACCTCATCCCGGGCAGCCCCCTGCCCCACGTGGGTGCTGCCCTCACAGTCACCACCCACCCCCACATCAGCATCAAGTCAGAACCGGTGTCCCCAAGCCGTGAGCGCAGCCCTGCGCCTCCCCCTCCAGCTGTGTTCCCAGCTGCCCGCCCTGAGCCTGGCGATGGTCTCAGCAGCCCAGCCGGGGGATCCTATGAGACGGGAGACCGGGATGACGGACGGGGGGACTTCGGGCCCACACTGGGCCTGCTGCGCCCAGCCCCAGAGCCTGAGGCTGAGGGCTCAGCTGTGAAGAGGATGCGGCTTGATA

Ensembl | human accession no.

ENSG00000116604

NCBI accession no.

NM_005920

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MEF2D(4209) , MEF2D(4209)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

FGF22 promotes generation of ribbon synapses through downregulating MEF2D.

Shuna Li et al.

Aging, 12(7), 6456-6466 (2020-04-10)

Cochlear ribbon synapses play a pivotal role in the prompt and precise acoustic signal transmission from inner hair cells (IHCs) to the spiral ganglion neurons, while noise and aging can damage ribbon synapses, resulting in sensorineural hearing loss. Recently, we

Targeting myocyte-specific enhancer factor 2D contributes to the suppression of cardiac hypertrophic growth by miR-92b-3p in mice.

Zhi-Qin Hu et al.

Oncotarget, 8(54), 92079-92089 (2017-12-02)

The role of microRNA-92b-3p (miR-92b-3p) in cardiac hypertrophy was not well illustrated. The present study aimed to investigate the expression and potential target of miR-92b-3p in angiotensin II (Ang-II)-induced mouse cardiac hypertrophy. MiR-92b-3p was markedly decreased in the myocardium of

Neuroprotective and neurogenic effects of novel tetramethylpyrazine derivative T-006 in Parkinson's disease models through activating the MEF2-PGC1α and BDNF/CREB pathways.

Haiyun Chen et al.

Aging, 12(14), 14897-14917 (2020-07-28)

T-006, a new derivative of tetramethylpyrazine, has been recently found to protect against 6-hydroxydopamine (6-OHDA)-induced neuronal damage and clear α-synuclein (α-syn) by enhancing proteasome activity in an α-syn transgenic Parkinson's disease (PD) model. The effect of T-006 on the 1-methyl-4-phenyl-1

ERK5 regulates basic fibroblast growth factor-induced type 1 plasminogen activator inhibitor expression and cell proliferation in lung fibroblasts.

Jung-Hwa Han et al.

Life sciences, 135, 1-8 (2015-06-03)

bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated

Macrophage migration inhibitory factor promotes expression of GLUT4 glucose transporter through MEF2 and Zac1 in cardiomyocytes.

Yeyou Liang et al.

Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)

Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico