Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU144441

Sigma-Aldrich

MISSION® esiRNA

targeting human SNX5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCGCTTCAGATTGACATACCTGATGCGCTCAGTGAGAGAGACAAAGTCAAATTTACAGTGCACACAAAGACCACACTGCCCACGTTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGGCTACATGACACTCTTATTGAAACAACAGACTATGCTGGGCTTATTATTCCACCTGCTCCTACGAAGCCCGACTTTGATGGTCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGTGAAGGGTCTATGACCAAAGAAGAATTTGCCAAGATGAAACAAGAACTGGAAGCTGAGTATCTCGCTGTGTTTAAGAAGACTGTGTCCTCCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGATCGCAACTTTCATGTTTTCCTGGAATATGATCAGGATCTAAGTGTTAGGCGGAAAAATACTAAAGAGATGTTTGGTGGCTTCTTCAAA

Ensembl | human accession no.

ENSG00000089006

NCBI accession no.

NM_014426

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SNX5(27131) , SNX5(27131)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nao Itai et al.
PloS one, 13(11), e0207205-e0207205 (2018-11-13)
Sorting nexin 5 (SNX5), a member of sorting nexin family, plays an important role in membrane trafficking, including the retrograde trafficking of the cation independent mannose 6-phosphate receptor (CI-M6PR) and macropinocytosis. Using ESI-LCMS/MS analysis, we confirmed that SNX5 serine 226
Jinyang Cai et al.
Journal of Cancer, 10(13), 2942-2952 (2019-07-10)
Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide. Long-term survival rates in patients with HNSCC have not increased significantly in the past 30 years. Therefore, looking for novel molecular targets that control HNSCC progression
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico