Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU142811

Sigma-Aldrich

MISSION® esiRNA

targeting human ROR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGAAGTGGAGGTTCTGGATCCGAACGACCCTTTAGGACCCCTTGATGGGCAGGACGGCCCGATTCCAACTCTGAAAGGTTACTTTCTGAATTTTCTGGAGCCAGTAAACAATATCACCATTGTCCAAGGCCAGACGGCAATTCTGCACTGCAAGGTGGCAGGAAACCCACCCCCTAACGTGCGGTGGCTAAAGAATGATGCCCCGGTGGTGCAGGAGCCGCGGCGGATCATCATCCGGAAGACAGAATATGGTTCACGACTGCGAATCCAGGACCTGGACACGACAGACACTGGCTACTACCAGTGCGTGGCCACCAACGGGATGAAGACCATTACCGCCACTGGCGTCCTGTTTGTGCGGCTGGGTCCAACGCACAGCCCAAATCATAACTTTCAGGATGATTACCACGAGGATGGGT

Ensembl | human accession no.

ENSG00000169071

NCBI accession no.

NM_004560

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ROR2(4920) , ROR2(4920)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Atsuko Ishizuya-Oka et al.
PloS one, 9(9), e107611-e107611 (2014-09-12)
Amphibian intestinal remodeling, where thyroid hormone (T3) induces some larval epithelial cells to become adult stem cells analogous to the mammalian intestinal ones, serves as a unique model for studying how the adult stem cells are formed. To clarify its
Marie R Webster et al.
Pigment cell & melanoma research, 28(2), 184-195 (2014-11-20)
We have previously shown that Wnt5A drives invasion in melanoma. We have also shown that Wnt5A promotes resistance to therapy designed to target the BRAF(V600E) mutation in melanoma. Here, we show that melanomas characterized by high levels of Wnt5A respond

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico