Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU139921

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCACCCGGATGAAGAACATTGAGTGCATTGAGCTGGGCCGGCACCGCCTCAAGCCGTGGTACTTCTCCCCGTACCCACAGGAACTCACCACATTGCCTGTCCTCTACCTGTGCGAGTTCTGCCTCAAGTACGGCCGTAGTCTCAAGTGTCTTCAGCGTCATTTGACCAAGTGTGACCTACGACATCCTCCAGGCAATGAGATTTACCGCAAGGGCACCATCTCCTTCTTTGAGATTGATGGACGTAAGAACAAGAGTTATTCCCAGAACCTGTGTCTTTTGGCCAAGTGTTTCCTTGACCATAAGACACTGTACTATGACACAGACCCTTTCCTCTTCTACGTCATGACAGAGTATGACTGTAAGGGCTTCCACATCGTGGGCTACTTCTCCAAGGAGAAAGAATCAACGGAAGACTACAATGTGGCCTGCATCCTAAC

Ensembl | human accession no.

ENSG00000172977

NCBI accession no.

NM_006388

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KAT5(10524) , KAT5(10524)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jian Li et al.
PloS one, 6(8), e23725-e23725 (2011-08-23)
GPR50 is an orphan G-protein coupled receptor most closely related to the melatonin receptors. The physiological function of GPR50 remains unclear, although our previous studies implicate the receptor in energy homeostasis. Here, we reveal a role for GPR50 as a
Xueqin Wang et al.
BMC microbiology, 10, 228-228 (2010-08-28)
Salmonella enterica is a facultative intracellular pathogen that replicates within a membrane-bound compartment termed Salmonella containing vacuole (SCV). The biogenesis of SCV requires Salmonella type III protein secretion/translocation system and their effector proteins which are translocated into host cells to
Shengyuan Zeng et al.
Protein & cell, 8(3), 202-218 (2016-10-16)
UHRF2 is a ubiquitin-protein ligase E3 that regulates cell cycle, genomic stability and epigenetics. We conducted a co-immunoprecipitation assay and found that TIP60 and HDAC1 interact with UHRF2. We previously demonstrated that UHRF2 regulated H3K9ac and H3K14ac differentially in normal
Deepa Rajagopalan et al.
PLoS pathogens, 13(10), e1006681-e1006681 (2017-10-19)
HIV1-TAT interactive protein (TIP60) is a haploinsufficient tumor suppressor. However, the potential mechanisms endowing its tumor suppressor ability remain incompletely understood. It plays a vital role in virus-induced cancers where TIP60 down-regulates the expression of human papillomavirus (HPV) oncoprotein E6
Mathieu Dalvai et al.
PLoS genetics, 9(4), e1003387-e1003387 (2013-05-03)
Histone variants, including histone H2A.Z, are incorporated into specific genomic sites and participate in transcription regulation. The role of H2A.Z at these sites remains poorly characterized. Our study investigates changes in the chromatin environment at the Cyclin D1 gene (CCND1)
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico