Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU134211

Sigma-Aldrich

MISSION® esiRNA

targeting human HRAS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAGGAGACCCTGTAGGAGGACCCCGGGCCGCAGGCCCCTGAGGAGCGATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTG

Ensembl | human accession no.

ENSG00000174775

NCBI accession no.

NM_001130442

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HRAS(3265) , HRAS(3265)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based
Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Satoshi Sugita et al.
International journal of oncology, 53(2), 725-736 (2018-06-15)
The active form of the small GTPase RAS binds to downstream effectors to promote cell growth and proliferation. RAS signal enhancement contributes to tumorigenesis, invasion, and metastasis in various different cancers. HRAS proto-oncogene GTPase (HRAS), one of the RAS isoforms
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico