Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU133631

Sigma-Aldrich

MISSION® esiRNA

targeting human ITCH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTGCCACCATACAAGAGCTATGAGCAACTGAAGGAAAAGCTGTTGTTTGCCATAGAAGAAACAGAAGGATTTGGACAAGAGTAACTTCTGAGAACTTGCACCATGAATGGGCAAGAACTTATTTGCAATGTTTGTCCTTCTCTGCCTGTTGCACATCTTGTAAAATTGGACAATGGCTCTTTAGAGAGTTATCTGAGTGTAAGTAAATTAATGTTCTCATTTAGATTTATCTCCCAGTGATTTCTACTCAGCGTTTCCAGAAATCAGGTCTGCAAATGACTAGTCAGAACCTTGCTTAACATGAGATTTTAACACAACAATGAAATTTGCCTTGTCTTATTCCACTAGTTTATTCCTTTAACAACAATATTTTATGTGTGTCAAAAGTCTCACTTGGGAGTAGTGTTTTTTTCTTTTAGACATTCTGCAGACATGCAGGGAAGTCCTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yoichiro Otaki et al.
Journal of the American Heart Association, 5(1) (2016-01-23)
The homologous to the E6-AP carboxyl terminus (HECT)-type ubiquitin E3 ligase ITCH is an enzyme that plays a pivotal role in posttranslational modification by ubiquitin proteasomal protein degradation. Thioredoxin-interacting protein (TXNIP) is a negative regulator of the thioredoxin system and
Lufen Chang et al.
Nucleic acids research, 47(2), 824-842 (2018-12-06)
The downregulation of the DNA damage response (DDR) enables aggressive tumors to achieve uncontrolled proliferation against replication stress, but the mechanisms underlying this process in tumors are relatively complex. Here, we demonstrate a mechanism through which a distinct E3 ubiquitin
Ji-Yeon Park et al.
Biochemical and biophysical research communications, 470(2), 336-342 (2016-01-23)
This study aimed to investigate the roles of autophagy and the ubiquitin-proteasome system in the degradation of histone deacetylase 8 (HDAC8) and to clarify the mechanism by which cAMP signaling regulates this degradation. cAMP signaling was activated by treating H1299

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico