Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU126361

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCGTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTTCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Feng Qiu et al.
Bioscience, biotechnology, and biochemistry, 82(8), 1366-1376 (2018-04-17)
The aim of the present study is to investigate the role of miR-21-5p in angiogenesis of human retinal microvascular endothelial cells (HRMECs). HRMECs were incubated with 5 mM glucose, 30 mM glucose or 30 mM mannitol for 24 h, 48 h or 72 h. Then, HRMECs
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based
Yu-Hsiang Lin et al.
Cancers, 12(1) (2019-12-22)
Maspin is a member of the clade B serine protease inhibitor superfamily and exhibits diverse regulatory effects in various types of solid tumors. We compared the expressions of maspin and determined its potential biological functions and regulatory mechanisms in bladder
Chikako Takeda et al.
Diagnostic pathology, 9, 205-205 (2014-11-02)
Maspin is a 42 kDa protein known to act as a tumor suppressor. Although its function has not been fully elucidated, numerous reports have investigated the prognostic impact of maspin in patients with several types of cancer. However, there have
Veronica Henderson et al.
Cell adhesion & migration, 9(4), 255-264 (2015-07-25)
Snail, a zinc-finger transcription factor, induces epithelial-mesenchymal transition (EMT), which is associated with increased cell migration and metastasis in cancer cells. Rac1 is a small G-protein which upon activation results in formation of lamellipodia, the first protrusions formed by migrating

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico