Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU125681

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTTCCTGTCCTGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGATGTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCCTGTCGCCAGTGGGCACTTTTTTTTTTCCACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGCAAGTTCAATAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ying Liu et al.
Cancer letters, 430, 1-10 (2018-05-08)
Our previous work has demonstrated that extracellular ATP is an important pro-invasive factor, and in this study, we tapped into a possible mechanism involved. We discovered that ATP could upregulate both the intracellular expression and secretion of S100A4 in breast
Zuliang Jie et al.
Journal of immunology (Baltimore, Md. : 1950), 198(9), 3448-3460 (2017-04-02)
Although large amounts of vitamin A and its metabolite all-
Hong Xia et al.
The Journal of clinical investigation, 127(7), 2586-2597 (2017-05-23)
Idiopathic pulmonary fibrosis (IPF) is a progressive disease with a prevalence of 1 million persons worldwide. The fibrosis spreads from affected alveoli into contiguous alveoli and leads to death by asphyxiation. We previously discovered that the IPF lung harbors fibrogenic
Giridhar Mudduluru et al.
Oncotarget, 8(13), 21081-21094 (2017-04-21)
The S100 calcium-binding protein A4 (S100A4) induces epithelial mesenchymal transition, migration, invasion, angiogenesis and metastasis. Its induced expression in several cancer types correlates with poor prognosis. Apart from the functional and transcriptional regulatory aspects of S100A4, its post-transcriptional regulation is
Xuelong Jiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(3), 1143-1162 (2018-09-10)
Anaplastic thyroid cancer (ATC), with 25% BRAFV600E mutation, is one of the most lethal human malignancies that currently has no effective therapy. Vemurafenib, a BRAFV600E inhibitor, has shown promise in clinical trials, including ATC patients, but is being hampered by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico