Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU125631

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jan Rossaint et al.
The Journal of clinical investigation, 126(3), 962-974 (2016-02-16)
Chronic kidney disease (CKD) has been associated with impaired host response and increased susceptibility to infections. Leukocyte recruitment during inflammation must be tightly regulated to protect the host against pathogens. FGF23 levels are increased in blood during CKD, and levels
Jian Chen et al.
Cell death & disease, 8(10), e3090-e3090 (2017-10-06)
Therapeutics used to treat central nervous system (CNS) injury were designed to repair neurites and inhibit cell apoptosis. Previous studies have shown that neuron-derived FGF10 exerts potential neuroprotective effects after cerebral ischemia injury. However, little is known about the role
Sergei Boichuk et al.
Anti-cancer drugs, 29(6), 549-559 (2018-04-27)
The acquired resistance of gastrointestinal stromal tumors (GISTs) to the targeted-based therapy remains the driving force to identify the novel approaches that are capable of increasing the sensitivity of GISTs to the current therapeutic regimens. Our present data show that
Alok R Khandelwal et al.
Molecular carcinogenesis, 58(10), 1715-1725 (2019-06-30)
Cutaneous squamous cell carcinoma (cSCC) is a keratinocyte-derived invasive and metastatic tumor of the skin. It is the second-most commonly diagnosed form of skin cancer striking 200 000 Americans annually. Further, in organ transplant patients, there is a 65- to 100-fold
Yu Sun et al.
Experimental and therapeutic medicine, 18(2), 1440-1448 (2019-07-19)
MicroRNAs (miRNAs) are frequently dysregulated in cervical cancer, and the aberrant regulation of miRNAs may be involved in the regulation of various cancer-associated biological processes. Therefore, further exploration of the specific roles of dysregulated miRNAs in cervical cancer and their

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico