Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU123791

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKDC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCGACTTGCGTGTGATGTTGATCAGGTGACAAGGCAACTGTATGAGCCACTAGTTATGCAGCTGATTCACTGGTTCACTAACAACAAGAAATTTGAAAGTCAGGATACTGTTGCCTTACTAGAAGCTATATTGGATGGAATTGTGGACCCTGTTGACAGTACTTTAAGAGATTTTTGTGGTCGGTGTATTCGAGAATTCCTTAAATGGTCCATTAAGCAAATAACACCACAGCAGCAGGAGAAGAGTCCAGTAAACACCAAATCGCTTTTCAAGCGACTTTATAGCCTTGCGCTTCACCCCAATGCTTTCAAGAGGCTGGGAGCATCACTTGCCTTTAATAATATCTACAGGGAATTCAGGGAAGAAGAGTCTCTGGTGGAACAGTTTGTGTTTGAAGCCTTGGTGATATACATGGAGAGTCTGGCCTTAGCACATGC

Ensembl | human accession no.

ENSG00000121031

NCBI accession no.

NM_001081640

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRKDC(5591) , PRKDC(5591)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bo Wang et al.
Cell cycle (Georgetown, Tex.), 18(21), 2876-2892 (2019-09-17)
Glioblastoma is the most aggressive brain tumor. Although miR-141 has been demonstrated to primarily function as a tumor suppressor in numerous malignancies, including glioblastoma, the mechanisms involved remain poorly understood. Here, it is shown that miR-141 is downregulated in glioblastoma
Shuai Li et al.
The FEBS journal, 286(12), 2341-2354 (2019-03-27)
Synthetic biology employs engineering principles to redesign biological systems for biomedical or industrial purposes. Innovation and application of original biological parts for genetic circuit construction will significantly facilitate and expedite the development of synthetic biology. Here, we built two- or
Sonia Paget et al.
Oncotarget, 8(2), 2916-2935 (2016-12-10)
The tumor suppressor gene HIC1 (Hypermethylated In Cancer 1) encodes a transcriptional repressor mediating the p53-dependent apoptotic response to irreparable DNA double-strand breaks (DSBs) through direct transcriptional repression of SIRT1. HIC1 is also essential for DSB repair as silencing of
E Dickreuter et al.
Oncogene, 35(11), 1353-1362 (2015-06-16)
β1 Integrin-mediated cell-extracellular matrix interactions allow cancer cell survival and confer therapy resistance. It was shown that inhibition of β1 integrins sensitizes cells to radiotherapy. Here, we examined the impact of β1 integrin targeting on the repair of radiation-induced DNA
Lin Jia et al.
The Journal of pathology, 243(2), 255-266 (2017-08-05)
Endostatin was discovered as an endogenous angiogenesis inhibitor with broad-spectrum antitumour activities. Although clinical efficacy was observed when endostatin was combined with standard chemotherapy for non-small cell lung cancer (NSCLC), as well as other cancer types, the specific mechanisms underlying
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico