Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU121691

Sigma-Aldrich

MISSION® esiRNA

targeting human ATAD2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAACCTACCACCGGACACGTGCTTTAAGATCTTTGAGAAAAGATGCACAGAATTCTTCAGATTCTAGTTTTGAGAAGAATGTGGAAATAACGGAGCAACTTGCTAATGGCAGGCATTTTACAAGGCAGTTGGCCAGACAGCAGGCTGATAAAAAAAAAGAAGAGCACAGAGAAGACAAAGTGATTCCAGTTACTCGGTCATTGAGGGCTAGAAACATCGTTCAAAGTACAGAACACTTACATGAAGATAATGGTGATGTTGAAGTGCGTCGAAGTTGTAGGATTAGAAGTCGTTATAGTGGTGTAAACCAGTCCATGCTGTTTGACAAACTTATAACTAACACTGCTGAAGCTGTACTTCAAAAAATGGATGACATGAAGAAGATGCGTAGACAGCGAATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

S Hong et al.
Neoplasma, 63(6), 846-855 (2016-08-28)
Colorectal cancer is one of the most common malignant tumors with a high rate of distant metastasis, postoperative recurrence and mortality. ATPase family AAA domain-containing protein 2 (ATAD2), a member of ATPase family, is highly expressed in various cancers, including
Le Zheng et al.
Oncology reports, 33(5), 2337-2344 (2015-03-31)
The ATPase family AAA domain-containing protein 2 (ATAD2) is associated with many cellular processes, such as cell proliferation, invasion and migration. However, the molecular biological function of the ATAD2 gene in cervical cancer is unclear. The purpose of this study
Wen-Jing Lu et al.
Oncotarget, 6(39), 41722-41735 (2015-10-27)
The ATPase family, AAA domain containing 2 (ATAD2) is highly expressed in multiple cancers. We aim to understand the clinical and biological significance of ATAD2 over-expression in hepatocellular carcinoma (HCC), as a means to validate it as a therapeutic target

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico