Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU120331

Sigma-Aldrich

MISSION® esiRNA

targeting human RHOB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACCGTCTTCGAGAACTATGTGGCCGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACGGCGGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATTCTCATGTGCTTCTCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTCCCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTGCGCACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCTGCCAAGACCAAGGAAGGCGTGCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAGAAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCAAGGTGCTATGAG

Ensembl | human accession no.

ENSG00000143878

NCBI accession no.

NM_004040

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RHOB(388) , RHOB(388)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Olivier Calvayrac et al.
EMBO molecular medicine, 9(2), 238-250 (2016-12-23)
Although lung cancer patients harboring EGFR mutations benefit from treatment with EGFR-tyrosine kinase inhibitors (EGFR-TKI), most of them rapidly relapse. RHOB GTPase is a critical player in both lung carcinogenesis and the EGFR signaling pathway; therefore, we hypothesized that it
Li-Juan Wei et al.
Chemico-biological interactions, 289, 9-14 (2018-04-17)
MicroRNAs (miRNAs) can function as tumor suppressor or oncogenic genes. The putative targets of miR-223 include tumor suppressor gene, RhoB. Here we sought to investigate the role of miR-223-RhoB signaling pathway in proliferation of colon cancer. We used Western blot
Shariq S Ansari et al.
Cellular oncology (Dordrecht), 40(1), 89-96 (2016-11-05)
Recently, we found that erufosine (erucylphospho-N,N,N trimethylpropylammonium) can induce up-regulation of RhoB expression in oral squamous carcinoma (OSCC) cells, thereby hinting at a tumor suppressive role. Therefore, we aimed to evaluate the role of RhoB in the tumor suppressive mode
Manon C A Pronk et al.
Molecular biology of the cell, 30(5), 607-621 (2019-01-03)
Rho GTPases control both the actin cytoskeleton and adherens junction stability and are recognized as essential regulators of endothelial barrier function. They act as molecular switches and are primarily regulated by the exchange of GDP and GTP. However, posttranslational modifications

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico