Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU119431

Sigma-Aldrich

MISSION® esiRNA

targeting human PDPN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCTCTTCGTTTTGGGAAGCGCGTCGCTCTGGGTCCTGGCAGAAGGAGCCAGCACAGGCCAGCCAGAAGATGACACTGAGACTACAGGTTTGGAAGGCGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCAAACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiang-Chao Li et al.
Molecular medicine reports, 10(3), 1513-1518 (2014-06-19)
Podoplanin (PDPN) is a well established lymphatic endothelial marker and has frequently been observed in cancer cells at the edge of cancer masses. Previous studies investigating the association between PDPN expression and patient prognosis have had contradictory results. In the
Ekele Ikpegbu et al.
Journal of cellular physiology, 233(7), 5334-5347 (2017-12-08)
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the
Lewis S C Ward et al.
Journal of cell science, 132(5) (2019-02-13)
Mesenchymal stromal cells (MSCs) upregulate podoplanin at sites of infection, chronic inflammation and cancer. Here, we investigated the functional consequences of podoplanin expression on the migratory potential of MSCs and their interactions with circulating platelets. Expression of podoplanin significantly enhanced
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico