Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU116371

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weining Wu et al.
Journal of experimental & clinical cancer research : CR, 38(1), 133-133 (2019-03-23)
Glioblastoma multiforme (GBM) is the most common and aggressive form of astrocytoma among adult brain tumors. Multiple studies have shown that long non-coding RNAs (lncRNAs) play important roles in acting as molecular sponge for competing with microRNAs (miRNAs) to regulate
Jie Liu et al.
BMC biochemistry, 4, 10-10 (2003-09-10)
Annexin II heavy chain (also called p36, calpactin I) is lost in prostate cancers and in a majority of prostate intraepithelial neoplasia (PIN). Loss of annexin II heavy chain appears to be specific for prostate cancer since overexpression of annexin
Jiajia Chen et al.
Neuropeptides, 61, 67-76 (2016-11-12)
Annexin A2 (ANXA2), is a member of the annexin family of proteins that exhibit Ca
Zhiyang Wang et al.
Journal of cellular and molecular medicine, 22(1), 429-438 (2017-09-01)
Tenascin-c is an extracellular matrix glycoprotein, the expression of which relates to the progression of atherosclerosis, myocardial infarction and heart failure. Annexin II acts as a cell surface receptor of tenascin-c. This study aimed to delineate the role of tenascin-c
Yuanhong Chang et al.
Oncology reports, 40(6), 3625-3634 (2018-10-03)
Recently, long non-coding RNA (lncRNA) FOXD2 adjacent opposite strand RNA 1 (FOXD2-AS1) has been recognized to function as an oncogene in several human tumors, and FOXD2‑AS1 dysregulation has been closely associated with carcinogenesis and tumor progression. Nevertheless, the correlation between the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico