Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU114701

Sigma-Aldrich

MISSION® esiRNA

targeting human CD46

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTCTCAGATGACGCCTGTTATAGAGAAACATGTCCATATATACGGGATCCTTTAAATGGCCAAGCAGTCCCTGCAAATGGGACTTACGAGTTTGGTTATCAGATGCACTTTATTTGTAATGAGGGTTATTACTTAATTGGTGAAGAAATTCTATATTGTGAACTTAAAGGATCAGTAGCAATTTGGAGCGGTAAGCCCCCAATATGTGAAAAGGTTTTGTGTACACCACCTCCAAAAATAAAAAATGGAAAACACACCTTTAGTGAAGTAGAAGTATTTGAGTATCTTGATGCAGTAACTTATAGTTGTGATCCTGCACCTGGACCAGATCCATTTTCACTTATTGGAGAGAGCACGATTTATTGTGGTGACAATTCAGTGTGGAGTCGTGCTGCTCCAGAGTGTA

Ensembl | human accession no.

ENSG00000117335

NCBI accession no.

NM_172352

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD46(4179) , CD46(4179)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kathryn R Stein et al.
Nature communications, 10(1), 2699-2699 (2019-06-22)
Human cytomegalovirus (CMV) causes a wide array of disease to diverse populations of immune-compromised individuals. Thus, a more comprehensive understanding of how CMV enters numerous host cell types is necessary to further delineate the complex nature of CMV pathogenesis and
Meng-Lay Lin et al.
Oncotarget, 6(25), 21685-21703 (2015-08-19)
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other
Pei Qiao et al.
Scientific reports, 7(1), 145-145 (2017-03-10)
Bullous pemphigoid (BP) is an autoimmune bullous disease caused by autoantibodies against BP180 in the epidermal basement membrane. Autoantibody-mediated complement activation is an important process in BP pathogenesis. CD46, a crucial complement regulatory protein in the complement activation, has been
J Song et al.
Cell death & disease, 6, e1844-e1844 (2015-08-08)
In the central nervous system (CNS), hyperglycemia leads to neuronal damage and cognitive decline. Recent research has focused on revealing alterations in the brain in hyperglycemia and finding therapeutic solutions for alleviating the hyperglycemia-induced cognitive dysfunction. Adiponectin is a protein

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico