Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU108431

Sigma-Aldrich

MISSION® esiRNA

targeting human GNAQ

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Grazia Ambrosini et al.
Molecular cancer therapeutics, 13(8), 2073-2080 (2014-06-06)
The majority of uveal melanomas carry oncogenic mutations in the G proteins GNAQ and GNA11, with consequent activation of the MAPK pathway. Selective MEK inhibitors, such as selumetinib, have shown clinical benefit in uveal melanoma. However, mechanisms of drug resistance
Eva Königshausen et al.
Scientific reports, 6, 39513-39513 (2016-12-23)
Glomerular permeability and subsequent albuminuria are early clinical markers for glomerular injury in hypertensive nephropathy. Albuminuria predicts mortality and cardiovascular morbidity. AT1 receptor blockers protect from albuminuria, cardiovascular morbidity and mortality. A blood pressure independent, molecular mechanism for angiotensin II
Honglei Liu et al.
Oncology reports, 34(1), 295-301 (2015-05-09)
The occurrence of guanine nucleotide binding protein (G protein), q polypeptide (GNAQ) mutations has been found to be high in the majority of uveal melanomas. However, the underlying molecular mechanism of GNAQ mutations in modulating uveal melanoma is poorly understood.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico