Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU108371

Sigma-Aldrich

MISSION® esiRNA

targeting human ACTR3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCAAAGGAGGGTGATGAAAGGTGTTGATGACCTAGACTTCTTCATTGGTGATGAAGCAATAGAAAAACCTACATATGCAACAAAGTGGCCAATCCGCCATGGTATAGTTGAAGATTGGGACTTAATGGAAAGGTTTATGGAGCAAGTGATCTTTAAATATTTAAGGGCAGAACCTGAAGACCATTATTTTCTTTTGACTGAACCTCCATTGAATACTCCAGAAAACAGGGAATATACTGCTGAAATAATGTTTGAGTCCTTCAATGTTCCAGGCTTGTACATTGCTGTGCAGGCTGTTCTTGCCTTAGCTGCATCTTGGACCTCAAGACAAGTAGGAGAACGGACGTTGACCGGTACGGTAATAGACAGTGGAGATGGTGTCACTCATGTCATTCCTGTGGCTGAAGGGTATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Daniel L Galvan et al.
The Journal of clinical investigation, 129(7), 2807-2823 (2019-05-08)
Phosphorylation of Dynamin-related protein1 (Drp1) represents an important regulatory mechanism for mitochondrial fission. Here we established the role of Drp1 Serine 600 (S600) phosphorylation on mitochondrial fission in vivo, and assessed the functional consequences of targeted elimination of the Drp1S600
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico