Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU098701

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sheng Yi et al.
Journal of cell science, 132(6) (2019-02-21)
Tau protein (encoded by the gene microtubule-associated protein tau, Mapt) is essential for the assembly and stability of microtubule and the functional maintenance of the nervous system. Tau is highly abundant in neurons and is detectable in astrocytes and oligodendrocytes.
Tomi Rantamäki et al.
PloS one, 8(7), e68722-e68722 (2013-07-12)
Brain-derived neurotrophic factor (BDNF) importantly regulates learning and memory and supports the survival of injured neurons. Reduced BDNF levels have been detected in the brains of Alzheimer's disease (AD) patients but the exact role of BDNF in the pathophysiology of
Varun Balaji et al.
Autophagy, 14(12), 2139-2154 (2018-08-28)
Missorting of MAPT/Tau represents one of the early signs of neurodegeneration in Alzheimer disease. The triggers for this are still a matter of debate. Here we investigated the sorting mechanisms of endogenous MAPT in mature primary neurons using microfluidic chambers

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico