Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU096141

Sigma-Aldrich

MISSION® esiRNA

targeting human MAX

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGATTCGCAGCACAGAGTCGCTGGCATGTTTCACTCCTGCTTCTCTCAGCCAGCTGTTTAAGCCTGCGGCGCCAGCCTCACGGAGGGCCGTGTGACACTCTCGTGGTATGTATGGGAGATGGCAGCAGTGAAGCAGCAGCCACCAGGGAGTGGCCATTTGGGGTTGGGACAGGGAGGGTGTTTTGGGTGGCATAGAGGTTTTGTATTGAGGGCCAGTGATGATGTTTTGATATTTATTTCCTGCTACTTAAATTTGAATCTGAGTGAATTGTACCTATTTCTGATGATGTCGGTCTTGC

Ensembl | human accession no.

ENSG00000125952

NCBI accession no.

NM_197957

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAX(4149) , MAX(4149)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tsz-Lun Yeung et al.
Oncotarget, 8(10), 16951-16963 (2017-02-16)
Transcription factors are master switches for various biochemical pathways. However, transcription factors involved in the pathogenesis of ovarian cancer have yet to be explored thoroughly. Therefore, in the present study, we assessed the prognostic value of the transcription factor E74-like
Olivier Godfroy et al.
The Plant cell, 29(12), 3102-3122 (2017-12-07)
Brown algae are one of the most developmentally complex groups within the eukaryotes. As in many land plants and animals, their main body axis is established early in development, when the initial cell gives rise to two daughter cells that
Mi-Ok Lee et al.
Biochemical and biophysical research communications, 520(2), 406-412 (2019-10-15)
Selenium (Se) plays a vital role in reactive oxygen species (ROS) homeostasis and redox regulation in intracellular signaling via selenocysteine (Sec), known as the 21st proteinogenic amino acid, but its specific biological functions in development and disease remain undiscovered. In
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM
Farah Sharieh et al.
Alcoholism, clinical and experimental research, 44(6), 1204-1213 (2020-04-19)
During bone fracture repair, resident mesenchymal stem cells (MSCs) differentiate into chondrocytes, to form a cartilaginous fracture callus, and osteoblasts, to ossify the collagen matrix. Our laboratory previously reported that alcohol administration led to decreased cartilage formation within the fracture
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico