Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU091151

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAACGTTCACTGCCCTGTCCAGCGAGAAGAGAGAGAAGCAGGAGGCGTCTGAGTCTCCAGTGAAGGCCGTACAGCCACACATCTCGCCCCTGACCATCAACATTCCAGACACCATGGCCCACCTCATCAGCCCTCTGCCCTCCCCCACGGGAACCATCAGCGCTGCAAACTCCTGCCCCTCCAGCCCCCGGGGAGCGGGGTCTTCAGGGTACAAGGTGGGCCGAGTGATGCCATCTGACCTCAATTTAATGGCTGACAACTCACAGCCTGAAAATGAAAAGGAAGCTTCAGGTGGAGACAGCCCGAAGGATGATTCAAAGCCGCCTTACTCCTACGCGCAGCTGATAGTTCAGGCGATTACGATGGCTCCCGACAAACAGCTCACCCTGAACGGGATTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dongni Wang et al.
Journal of diabetes and its complications, 33(5), 374-382 (2019-03-14)
MicroRNAs (miRNAs) have emerged as promising regulators of diabetes mellitus (DM)-induced angiogenic dysfunction in endothelial cells (ECs), but information vis-à-vis the functional roles of distinct miRNAs remain surprisingly scarce. The current study was designed to elucidate the expression and function
Yuping Chen et al.
Science advances, 6(1), eaax5819-eaax5819 (2020-01-09)
Autophagy is an evolutionarily conserved catabolic process, which plays a vital role in removing misfolded proteins and clearing damaged organelles to maintain internal environment homeostasis. Here, we uncovered the checkpoint kinase 2 (CHK2)-FOXK (FOXK1 and FOXK2) axis playing an important

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico