Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU084091

Sigma-Aldrich

MISSION® esiRNA

targeting human ARRB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCACGCTTACCCTTTCACCTTTGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAGACACGGGGAAGGCTTGCGGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGGAGGAGAAGATCCACAAGCGGAATTCTGTGCGTCTGGTCATCCGGAAGGTTCAGTATGCCCCAGAGAGGCCTGGCCCCCAGCCCACAGCCGAGACCACCAGGCAGTTCCTCATGTCGGACAAGCCCTTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCATGGAGAACCCATCAGCGTCAACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCTCAGTGCGCCAGTATGCAGACATCTGCCTTTTCAACACAGCTCAGTACAAGTGCCCTGTTGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui Yamaguchi et al.
The American journal of the medical sciences, 357(6), 492-506 (2019-03-27)
Plasminogen activator inhibitor type 1 promotes formation of endothelial microparticles with procoagulant activity. However, it remains unclear whether di-(2-ethylhexyl) phthalate, a peroxisome proliferator-activated receptor α agonist, influences microparticle formation. The effect of di-(2-ethylhexyl) phthalate on release of tissue factor-bearing microparticles
Vincent Zecchini et al.
The EMBO journal, 33(12), 1365-1382 (2014-05-20)
Tumour cells sustain their high proliferation rate through metabolic reprogramming, whereby cellular metabolism shifts from oxidative phosphorylation to aerobic glycolysis, even under normal oxygen levels. Hypoxia-inducible factor 1A (HIF1A) is a major regulator of this process, but its activation under
Susanne Neumann et al.
The Journal of pharmacology and experimental therapeutics, 364(1), 38-45 (2017-11-02)
Recently, we showed that TSH-enhanced differentiation of a human preosteoblast-like cell model involved a β-arrestin 1 (β-Arr 1)-mediated pathway. To study this pathway in more detail, we sought to discover a small molecule ligand that was functionally selective toward human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico