Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU081921

Sigma-Aldrich

MISSION® esiRNA

targeting human ACLY

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCCCATGGAGTTTGTGAACAAGATGAAGAAGGAAGGGAAGCTGATCATGGGCATTGGTCACCGAGTGAAGTCGATAAACAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAGGCAGCACTTCCCTGCCACTCCTCTGCTCGATTATGCACTGGAAGTAGAGAAGATTACCACCTCGAAGAAGCCAAATCTTATCCTGAATGTAGATGGTCTCATCGGAGTCGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAGGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGGTTCATTGGACACTATCTTGATCAGAAGAGGCTGAAGCAGGGGCTGTATCGTCATCCGTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ACLY(47) , ACLY(47)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mei Xin et al.
Oncotarget, 7(28), 44252-44265 (2016-06-19)
MicroRNAs (miRNAs) are non-coding small RNAs that function as negative regulators of gene expression involving in the tumor biology. ATP citrate lyase (ACLY), a key enzyme initiating de novo lipid synthesis, has been found to be upregulated in cancer cells
Supriya Shah et al.
Oncotarget, 7(28), 43713-43730 (2016-06-02)
The androgen receptor (AR) plays a central role in prostate tumor growth. Inappropriate reactivation of the AR after androgen deprivation therapy promotes development of incurable castration-resistant prostate cancer (CRPC). In this study, we provide evidence that metabolic features of prostate
Li Lai et al.
Circulation, 139(1), 119-133 (2018-12-28)
We have previously shown that activation of cell-autonomous innate immune signaling facilitates the transdifferentiation of fibroblasts into induced endothelial cells, and is required to generate induced endothelial cells with high fidelity for endothelial lineage. Recent studies indicate that a glycolytic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico