Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU079871

Sigma-Aldrich

MISSION® esiRNA

targeting human TEAD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTTTATTTCTAGTGACCCAATATGCATATTAACCTGCTATAACTAGGGCTATATGTGTAGGTATGTGTATACATATACACAAATGCACATATAGAGTTAACACATTTAGTGAACACTTGTTTAGTGTCACTCAGTTTGCTAGGTGCTGATATGTACGTATATCTCAATGTGTCTGTAGACTTAGATACATCCTCTTGAAGCACATCCATTTCTTTAGCGTCTCTCAGTAAGTTACAGTACTTGTTTGACTTAGGTTTAAGAGGCCCAGCTACCTATCTCTGACCTTTTCAAATAGGCTCATTTGGGAGATTCTTTTGCCAGGAGAGATTCAACTTTCCAATCTAAGTATTCCAGAGCATTGCCCAGGCAGAGTTGGTTTGATGTGGCCAGATGTTTTGAGTTATTTCCCTTAAGTGTTTCACTGGGGAGAGAACAGGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Min-Hao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 496-501 (2016-10-25)
Colorectal cancer (CRC) is the most common type of gastrointestinal cancer. However, up to date, the specific mechanism for CRC proliferation remains unclear. Transcriptional enhancer activator domain 1 (TEAD1) is a transcription factor belongs to the TEAD family, which plays
Shi Jiao et al.
Nature communications, 8, 14058-14058 (2017-01-05)
Concerted co-regulation of multiple signalling pathways is crucial for tissue homoeostasis and tumorigenesis. Here we report that VGLL4, a previously identified YAP antagonist, also functions as a regulator of Wnt/β-catenin signalling. The expression of VGLL4 is significantly downregulated in clinical
Claudia Stein et al.
PLoS genetics, 11(8), e1005465-e1005465 (2015-08-22)
YAP1 is a major effector of the Hippo pathway and a well-established oncogene. Elevated YAP1 activity due to mutations in Hippo pathway components or YAP1 amplification is observed in several types of human cancers. Here we investigated its genomic binding

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico