Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU077841

Sigma-Aldrich

MISSION® esiRNA

targeting human LARP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTACCGAAAGTTTGATGGTGTGGAGGGGCCTCGTACGCCCAAGTACATGAACAACATCACCTACTACTTTGACAATGTCAGCAGCACCGAGCTTTACAGTGTGGATCAGGAACTGCTCAAAGACTACATCAAGCGCCAGATTGAATACTACTTCAGCGTGGACAATTTAGAGCGAGACTTCTTCCTGCGAAGGAAAATGGATGCTGATGGTTTCCTACCCATCACCCTTATTGCTTCCTTCCACCGAGTGCAGGCCCTTACCACTGACATTTCACTCATCTTTGCGGCCCTAAAGGACAGCAAGGTGGTGGAGATCGTTGATGAGAAAGTTCGTAGGAGGGAGGAACCAGAAAAGTGGCCTCTTCCCCCAATAGTGGATTATTCACAGACTGATTTCTCCCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Johannes H Wilbertz et al.
Molecular cell, 73(5), 946-958 (2019-01-22)
Biological phase transitions form membrane-less organelles that generate distinct cellular environments. How molecules are partitioned between these compartments and the surrounding cellular space and the functional consequence of this localization is not well understood. Here, we report the localization of
Marie-Laure Plissonnier et al.
Virus research, 271, 197679-197679 (2019-08-10)
Hepatitis C virus (HCV) virions contain a subset of host liver cells proteome often composed of interesting virus-interacting factors. A proteomic analysis performed on double gradient-purified clinical HCV highlighted the translation regulator LARP1 on these virions. This finding was validated
Ewan M Smith et al.
Nucleic acids research, 49(1), 458-478 (2020-12-18)
The mammalian target of rapamycin (mTOR) is a critical regulator of cell growth, integrating multiple signalling cues and pathways. Key among the downstream activities of mTOR is the control of the protein synthesis machinery. This is achieved, in part, via
Maria Dermit et al.
Developmental cell, 55(3), 298-313 (2020-11-11)
Translation of ribosomal protein-coding mRNAs (RP-mRNAs) constitutes a key step in ribosome biogenesis, but the mechanisms that modulate RP-mRNA translation in coordination with other cellular processes are poorly defined. Here, we show that subcellular localization of RP-mRNAs acts as a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico