Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU070021

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCAAGTCCAACAGCAATGCCGTCTCCGCCATCCCTATTAACAAGGACAACCTCTTCGGCGGCGTGGTGAACCCCAACGAAGTCTTCTGTTCAGTTCCGGGTCGCCTCTCGCTCCTCAGCTCCACCTCGAAGTACAAGGTCACGGTGGCGGAAGTGCAGCGGCGGCTCTCACCACCCGAGTGTCTCAACGCGTCGCTGCTGGGCGGAGTGCTCCGGAGGGCGAAGTCTAAAAATGGAGGAAGATCTTTAAGAGAAAAACTGGACAAAATAGGATTAAATCTGCCTGCAGGGAGACGTAAAGCTGCCAACGTTACCCTGCTCACATCACTAGTAGAGGGAGAAGCTGTCCACCTAGCCAGGGACTTTGGGTACGTGTGCGAAACCGAATTTCCTGCCAAAGCAGTAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fuchao Zhang et al.
Neurochemical research, 44(12), 2776-2785 (2019-10-28)
Transcription factors regulate the transcriptions and expressions of numerous target genes and direct a variety of physiological and pathological activities. To obtain a better understanding of the involvement of transcription factors during peripheral nerve repair and regeneration, significantly differentially expressed
Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico