Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU069871

Sigma-Aldrich

MISSION® esiRNA

targeting human NRF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGTGACCCAAACCGAACATATGGCTACCATAGAAGCACATGCAGTGGCCCAGCAAGTGCAGCAGGTCCATGTGGCTACTTACACCGAGCATAGTATGCTGAGTGCTGATGAAGACTCGCCTTCTTCTCCCGAGGACACCTCTTACGATGACTCAGATATACTCAACTCCACAGCAGCTGATGAGGTGACAGCTCATCTGGCAGCTGCAGGTCCTGTGGGAATGGCCGCTGCTGCTGCTGTGGCAACAGGAAAGAAACGGAAACGGCCTCATGTATTTGAGTCTAATCCATCTATCCGGAAGAGGCAACAAACACGTTTGCTTCGGAAACTTCGAGCCACGTTAGATGAATATACTACTCGTGTGGGACAGCAAGCTATTGTCCTCTGTATCTCACCCTCCAAACCTAACCCTGTCTTTAAAGTGTTTGGTGCAGCACCTTTGGAGAATGTGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Victoria Sid et al.
Journal of molecular medicine (Berlin, Germany), 96(11), 1203-1213 (2018-09-05)
Folate is an essential micronutrient for biological function. The liver, a primary organ for folate metabolism and storage, plays an important role in folate homeostasis. Proton-coupled folate transporter (PCFT) and reduced folate carrier (RFC) are the major folate transporters responsible
Luqing Zhao et al.
Oncotarget, 6(18), 15995-16018 (2015-07-24)
microRNAs (miRNAs) are involved in the various processes of DNA damage repair and play crucial roles in regulating response of tumors to radiation therapy. Here, we used nasopharyngeal carcinoma (NPC) radio-resistant cell lines as models and found that the expression
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico