Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU066891

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCCCAAACTGTCAGAAATAGGGACGATTGCCTGGATGATAACGCTCTGCGATGCCCTCCACAATTTCATCGATGGCCTGGCGATTGGGGCTTCCTGCACCTTGTCTCTCCTTCAGGGACTCAGTACTTCCATAGCAATCCTATGTGAGGAGTTTCCCCACGAGTTAGGAGACTTTGTGATCCTACTCAATGCAGGGATGAGCACTCGACAAGCCTTGCTATTCAACTTCCTTTCTGCATGTTCCTGCTATGTTGGGCTAGCTTTTGGCATTTTGGTGGGCAACAATTTCGCTCCAAATATTATATTTGCACTTGCTGGAGGCATGTTCCTCTATATTTCTCTGGCAGATATGTTTCCAGAGATGAATGATATGCTGAGAGAAAAGGTAACTGGAAGAAAAACCGATTTCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ken Kijima et al.
EBioMedicine, 41, 659-669 (2019-03-25)
Spinal cord injury (SCI) is a devastating disorder for which the accurate prediction of the functional prognosis is urgently needed. Due to the lack of reliable prediction methods, the acute evaluation of SCI severity and therapeutic intervention efficacy is extremely
Richard Coffey et al.
American journal of physiology. Cell physiology, 312(2), C169-C175 (2016-12-03)
The relationship between iron and β-cell dysfunction has long been recognized as individuals with iron overload display an increased incidence of diabetes. This link is usually attributed to the accumulation of excess iron in β-cells leading to cellular damage and
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico