Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU065091

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGAAGCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTCAGGATAAGGTTGCTTCAGTTATTAACATCAACCCCAATACAACTCACTCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAGTATCTAGACTTTGTCTTTGCTGTGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCAGCATGTATTTGGTTAATGGCTCCGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGCCCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATTTCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGA

Ensembl | human accession no.

ENSG00000005893

NCBI accession no.

NM_002294

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LAMP2(3920) , LAMP2(3920)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anne-Sophie Bach et al.
Oncotarget, 6(29), 28084-28103 (2015-07-18)
The lysosomal protease cathepsin D (Cath-D) is overproduced in breast cancer cells (BCC) and supports tumor growth and metastasis formation. Here, we describe the mechanism whereby Cath-D is accumulated in the nucleus of ERα-positive (ER+) BCC. We identified TRPS1 (tricho-rhino-phalangeal-syndrome
Vikash Singh et al.
The Journal of biological chemistry, 292(5), 1847-1864 (2016-12-10)
Salmonella enterica are invasive intracellular pathogens that replicate within a membrane-bound compartment inside infected host cells known as the Salmonella-containing vacuole. How Salmonella obtains nutrients for growth within this intracellular niche despite the apparent isolation is currently not known. Recent
Chuan-Ying Xu et al.
Frontiers in aging neuroscience, 9, 308-308 (2017-10-13)
α-Synuclein misfolding and aggregation play an important role in the pathogenesis of Parkinson's disease (PD). Loss of function and mutation of the PARK7/DJ-1 gene cause early-onset familial PD. DJ-1 can inhibit α-synuclein aggregation, and may function at an early step
Anders P Mutvei et al.
Nature communications, 11(1), 1416-1416 (2020-03-19)
The kinase mTOR complex 1 (mTORC1) promotes cellular growth and is frequently dysregulated in cancers. In response to nutrients, mTORC1 is activated on lysosomes by Rag and Rheb guanosine triphosphatases (GTPases) and drives biosynthetic processes. How limitations in nutrients suppress

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico