Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU062901

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATGTCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGGATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTATCCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCCAGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Poyil Pratheeshkumar et al.
International journal of molecular sciences, 22(2) (2021-01-10)
Chromodomain-helicase-DNA-binding protein 4 (CHD4), a core subunit of the nucleosome remodeling and deacetylation (NuRD) complex is highly expressed in several cancers. However, its role in the pathogenesis and progression of papillary thyroid carcinoma (PTC) has not been investigated. We investigated
Zhongliang Zhao et al.
Nucleic acids research, 44(17), 8144-8152 (2016-06-04)
Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico