Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU060371

Sigma-Aldrich

MISSION® esiRNA

targeting human TTBK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAGGCACATTCACCATTAGTACCACTCTCCGGCTGGGTAGACAGATTTTGGAGTCTATTGAAAGCATTCATTCTGTGGGATTCTTGCATCGAGACATCAAACCGTCGAACTTCGCTATGGGTCGCTTTCCTAGTACATGTAGGAAATGTTACATGCTTGATTTTGGCTTGGCTCGACAATTTACCAATTCCTGTGGTGACGTCAGACCACCTCGAGCTGTGGCAGGTTTTCGAGGGACAGTTCGTTATGCATCAATCAACGCACATCGGAACAGGGAAATGGGAAGACATGATGACCTTTGGTCCTTATTCTACATGTTGGTGGAGTTTGTGGTTGGTCAGCTGCCCTGGAGAAAAATAAAGGACAAGGAGCAAGTAGGCTCTATTAAGGAGAGATATGACCACAGGCTCATGTTGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xing Liu et al.
Oncotarget, 6(33), 34309-34320 (2015-09-30)
Hepatocellular carcinoma (HCC) is one of the most malignant cancers with poor clinical outcome. The protein kinase human monopolar spindle 1 (hMps1/TTK) gene expression is significantly increased in HCCs. However, its contributions to hepatocarcinogenesis remain unclear. In this study, we
Mi-Young Lee et al.
Cell division, 9, 3-3 (2014-10-04)
Centrosome amplification (CA) amongst particular breast cancer subtypes (Her2+ subtype) is associated with genomic instability and aggressive tumor phenotypes. However, changes in signaling pathways associated with centrosome biology have not been fully explored in subtype specific models. Novel centrosome regulatory
Takashi Watanabe et al.
The Journal of cell biology, 210(5), 737-751 (2015-09-02)
Microtubules (MTs) play critical roles in various cellular events, including cell migration. End-binding proteins (EBs) accumulate at the ends of growing MTs and regulate MT end dynamics by recruiting other plus end-tracking proteins (+TIPs). However, how EBs contribute to MT

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico