Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU059361

Sigma-Aldrich

MISSION® esiRNA

targeting human GFI1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGACACAAATAGGCTCCTCTACACCTGAAGACAAAGGCAAAGTCAAATGGGGACCAGAATAAATCTTAGACCCCACAGTCCTTCCCATTTCCAGCCCTAATCTACAGACAGGAATGCCCTTCAGGTTTCTTCCCTCCCCCCTCTTGACCTACCCCAGATATTTGTGTGGAAGAGGAGGAATCACCATTTACAAGGTGGACAAATGCTAATATTTTTATCTAGAAAGAAGAGTGAGTGTTAACTTTTATTTTTTTCCTTCTGGGGGGTCTGTTGACTCCTTTCTTTTGGGTGCTGCCTATAAATCTTGGAGGAATCATTTCTCCTCCTCAAAAACTGATTCAGAAACTGACTTGGGGAAGGAATTTAATACTTTGAAGTCATGAGATGCACCATCGAGGCTACCCCCAAGAAGAAGCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongbing Cai et al.
Cancer management and research, 10, 2849-2857 (2018-09-11)
The independent growth factor 1 (Gfi-1) is a transcription factor essential for several diverse hematopoietic functions and developments. However, the role and molecular mechanism of Gfi-1 in the development and progression of cervical cancer remains unclear. The present study investigates
Giacomo Volpe et al.
Scientific reports, 7(1), 11148-11148 (2017-09-13)
Growth Factor Independence 1 (GFI1) is a transcriptional repressor that plays a critical role during both myeloid and lymphoid haematopoietic lineage commitment. Several studies have demonstrated the involvement of GFI1 in haematological malignancies and have suggested that low expression of
Juraj Adamik et al.
Molecular cancer research : MCR, 15(4), 405-417 (2017-01-26)
In multiple myeloma, osteolytic lesions rarely heal because of persistent suppressed osteoblast differentiation resulting in a high fracture risk. Herein, chromatin immunoprecipitation analyses reveal that multiple myeloma cells induce repressive epigenetic histone changes at the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico