Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU059281

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATCCTGGGCTTAGTGAAACTACCAACCCTATGGGTCATATGTAAACATCAGCCAGTTCCAGAGTTATCAGTAGGCTAGATAGAAGGTGACCTCTCCTCATAAGGACTTGGACAACTCAGATTATCTGAAGACACAAACCTGACAGGAGGGAGAAGAAAAAACAAAACACTTGAACCAAGAAACTCAAATGTAATCCTACGATCAAAGCAACTGGTCAACACTTCCATCAGAAGTGAAGATAGGAAGCTCATCAGATAGAACATCAGCCCATGAGATGTTTGCAACAAATCTTTTGTTGCAAGCAGTGTGTCGCTTCTGCACAATCAGAGACTGTCTCGATCTCTCCACTCACCGTGGAAGTTGCCTTGTGCCTAAACTGAATTGACAAATGCATTGTAACTACAAATTTTATTTATTGTTATGAAACTGTAAGGTCTACATATAAAGGGAAAAAGTTAATGTGGAAAGCTGATCTACACTCAGCTGATGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Paulo R D V Godoy et al.
Molecular medicine reports, 14(6), 5253-5260 (2016-10-26)
Glioblastoma multiforme (GBM) is a lethal tumor and novel strategies are required to overcome resistance. Transcription factor 12 (HEB) has been associated with neural and stem cell proliferation, is overexpressed in certain tumor types and is induced in irradiated U87MG cells.
Leila Pirhaji et al.
Nature communications, 8(1), 623-623 (2017-09-22)
The immense and growing repositories of transcriptional data may contain critical insights for developing new therapies. Current approaches to mining these data largely rely on binary classifications of disease vs. control, and are not able to incorporate measures of disease
Duo Wen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(8), 6211-6221 (2015-03-11)
Malic enzyme 1 (ME1) links the glycolytic and citric acid cycles and is important for NADPH production, glutamine metabolism, and lipogenesis. Recently, its deregulation has been implicated in the progression of various cancers. However, the role of ME1 in the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico