Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU055401

Sigma-Aldrich

MISSION® esiRNA

targeting human BAG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGCAGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCACAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCTGACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAGGATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAGTTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shutong Liu et al.
Journal of translational medicine, 15(1), 189-189 (2017-09-08)
In order to improve therapy for head and neck squamous cell carcinoma (HNSCC), biomarkers associated with local and/or distant tumor relapses and cancer drug resistance are urgently needed. This study identified a potential biomarker, Bcl-2 associated athanogene-1 (BAG-1), that is
Pelin Ozfiliz Kilbas et al.
Molecular biology reports, 46(1), 847-860 (2019-01-21)
The multifunctional anti-apoptotic Bag-1 protein has important roles in apoptosis, proteasome-mediated degradation, transcriptional regulation, and intracellular signaling. Bag-1 promotes cell survival and proliferation, and is overexpressed in breast cancer. Therefore, Bag-1-targeted therapy might be a promising strategy to treat breast
Zhili Shen et al.
Molecular medicine reports, 17(5), 7435-7441 (2018-03-24)
Cinobufacini is widely used in the treatment of advanced cancers. It has been previously reported that microRNA (miR)‑494 was upregulated in cinobufacini‑treated gastric cancer cells; however, the detailed role of miR‑494 in the anti‑tumor activity of cinobufacini is unclear. The
Pelin Ozfiliz et al.
Cell biochemistry and function, 33(5), 293-307 (2015-07-17)
Bag-1, Bcl-2 associated athanogene-1, is a multifunctional protein that can regulate a wide variety of cellular processes: proliferation, cell survival, transcription, apoptosis and motility. Bag-1 interacts with various targets in the modulation of these pathways; yet molecular details of Bag-1's

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico