Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU046951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARG2, VTI1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGAGGAAGAGGCGAAGACTACAGCTAACCTGGCAGTAGATGTGATTGCTTCAAGCTTTGGTCAGACAAGAGAAGGAGGGCATATTGTCTATGACCAACTTCCTACTCCCAGTTCACCAGATGAATCAGAAAATCAAGCACGTGTGAGAATTTAGGAGACACTGTGCACTGACATGTTTCACAACAGGCATTCCAGAATTATGAGGCATTGAGGGGATAGATGAATACTAAATGGTTGTCTGGGTCAATACTGCCTTAATGAGAACATTTACACATTCTCACAATTGTAAAGTTTCCCCTCTATTTTGGTGACCAATACTACTGTAAATGTATTTGGTTTTTTGCAGTTCACAGGGTATTAATATGCTACAGTACTATGTAAATTTAAAGAAGTCATAAACAGCATTTATTACCTTGGTATATCATACTGGTCTTGTTGCTGTTGTTCCTTCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+
Bon-Hyeock Koo et al.
Cells, 9(2) (2020-02-13)
Arginase II reciprocally regulates endothelial nitric oxide synthase (eNOS) through a p32-dependent Ca2+ control. We investigated the signaling pathway of arginase II-dependent eNOS phosphorylation. Western blot analysis was applied for examining protein activation and [Ca2+]c was analyzed by microscopic and
Kwanhoon Choi et al.
Molecular medicine reports, 22(3), 2395-2403 (2020-07-25)
The p32 protein plays a crucial role in the regulation of cytosolic Ca2+ concentrations ([Ca2+]c) that contributes to the Ca2+‑dependent signaling cascade. Using an adenovirus and plasmid p32‑overexpression system, the aim of the study was to evaluate the role of p32

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico