Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU034001

Sigma-Aldrich

MISSION® esiRNA

targeting human CNN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGTTCTCAGCGTCAGTGCCGCCACTGCCCCCGCCAGAGCCCACCGGCCAGCATGTCCTCTGCTCACTTCAACCGAGGCCCTGCCTACGGGCTGTCAGCCGAGGTTAAGAACAAGCTGGCCCAGAAGTATGACCACCAGCGGGAGCAGGAGCTGAGAGAGTGGATCGAGGGGGTGACAGGCCGTCGCATCGGCAACAACTTCATGGACGGCCTCAAAGATGGCATCATTCTTTGCGAATTCATCAATAAGCTGCAGCCAGGCTCCGTGAAGAAGATCAATGAGTCAACCCAAAATTGGCACCAGCTGGAGAACATCGGCAACTTCATCAAGGCCATCACCAAGTATGGGGTGAAGCCCCACGACATTTTTGAGGCCAACGACCTGTTTGAGAACACCAACCATACACAGGTGCAGTCCACCCTCCTGGCTTTGGCCAGCATGGCGAAGACGAAAGGAAACAAGGTGAACGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zheng Wang et al.
Aging, 12(2), 1867-1887 (2020-01-28)
Breast cancer has been the second most prevalent and fatal malignancy due to its frequent metastasis to other organs. We aim to study the effects of a key miRNA-mRNA signaling in breast cancer. CNN1 was identified as the key gene
Kai-Hung Wang et al.
Oncotarget, 8(37), 61133-61145 (2017-10-06)
Increasing evidence indicates that ovarian high-grade serous carcinoma (HGSC) originates from the fallopian tube epithelium and metastasizes to the ovary as the secondary site. A working hypothesis is that detached tubal HGSC cells survive anoikis and implant on the ovary.
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico