Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU031761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGGTCTGCTTGTGTTCAATGCCTCAGACAGGTTCGAAGGCATCACCACGCTGCCCAATATCACAGTTACTGACTATCCCAAACAGATCTTCAGGGTGAAAACCACCCAGTTTACATGGACTGAAATGCTAATTATGGTCTGGGTTCTTGGAATGATGTGGTCTGAATGTAAAGAGCTCTGGCTGGAAGGACCTAGGGAATACATTTTGCAGTTGTGGAATGTGCTTGACTTTGGGATGCTGTCCATCTTCATTGCTGCTTTCACAGCCAGATTCCTAGCTTTCCTTCAGGCAACGAAGGCACAACAGTATGTGGACAGTTACGTCCAAGAGAGTGACCTCAGTGAAGTGACACTCCCACCAGAGATACAGTATTTCACTTATGCTAGAGATAAATGGCTCCCTTCTGACCCTCAGATTATATCTGAAGGCCTTTATGCCATAGCTGTTGTGCTCAGCTTCTCTCGGATTGCGTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lingwei Wang et al.
Biochemical and biophysical research communications, 484(1), 209-217 (2016-12-31)
Airway hyperresponsiveness (AHR), airway remodeling and inflammation are the fundamental pathological alterations that occur in asthma. Transient receptor potential canonical 3 (TRPC3) has been implicated in diverse functions of airway smooth muscle cells (ASMCs) in asthma. However, the underlying mechanisms
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Xiao-Xu Chen et al.
Life sciences, 187, 64-73 (2017-08-15)
Canonical transient receptor potential channel-3 (TRPC3)-encoded Ca Primary mouse ASMCs were cultured with or without ACh treatment, then cell viability, TRPC3 expression, NSCC currents and [Ca TRPC3 blocker Gd Our data suggested ACh could induce ASMC proliferation, and TRPC3 may
Pengzhou Hang et al.
International journal of biological sciences, 11(5), 536-545 (2015-04-22)
Brain-derived neurotrophic factor (BDNF) is associated with coronary artery diseases. However, its role and mechanism in myocardial infarction (MI) is not fully understood. Wistar rat and Kunming mouse model of MI were induced by the ligation of left coronary artery.
Kexin Meng et al.
PloS one, 9(6), e98777-e98777 (2014-06-07)
Calcium-sensing receptor (CaSR) has been demonstrated to be present in several tissues and cells unrelated to systemic calcium homeostasis, where it regulates a series of diverse cellular functions. A previous study indicated that CaSR is expressed in mouse glomerular mesangial

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico